...

metode taksonomi organisme berdasarkan sejarah evolusi

by user

on
Category: Documents
1

views

Report

Comments

Transcript

metode taksonomi organisme berdasarkan sejarah evolusi
N.L.P. INDI DHARYAMANTI: Filogenetika Molekuler: Metode Taksonomi Organisme Berdasarkan Sejarah Evolusi
FILOGENETIKA MOLEKULER: METODE TAKSONOMI ORGANISME
BERDASARKAN SEJARAH EVOLUSI
N.L.P. INDI DHARMAYANTI
Balai Besar Penelitian Veteriner, Jl. R.E. Martadinata No. 30, Bogor 16114
(Makalah diterima 4 Januari 2011 – 9 Maret 2011)
ABSTRAK
Filogenetika digambarkan sebagai klasifikasi secara taksonomi dari suatu organisme berdasarkan pada sejarah evolusi yaitu
filogeninya mereka dan merupakan bagian integral dari ilmu pengetahuan yang sistematik yang mempunyai tujuan untuk
menentukan filogeni dari organisme berdasarkan pada karakteristiknya. Analisis filogenetika sekuen asam amino dan protein
biasanya akan menjadi wilayah yang penting dalam analisis sekuen. Analisis filogenetika juga digunakan untuk mengikuti
perubahan yang terjadi secara cepat yang mampu mengubah suatu spesies, seperti virus. Pohon evolusi adalah sebuah grafik dua
dimensi yang menunjukkan hubungan diantara organisme atau lebih spesifik lagi adalah sekuen gen dari organisme. Pemisahan
sekuen disebut taxa (atau taxon jika tunggal) yang didefinisikan sebagai jarak filogenetika unit pada sebuah pohon. Pohon terdiri
dari cabang-cabang luar (outer branches) atau daun-daun (leaves) yang merepresentasikan taxa dan titik-titik (nodes) dan cabang
merepresentasikan hubungan diantara taxa, Ketika sekuen nukleotida atau protein dari dua organisme yang berbeda mempunyai
kemiripan, maka mereka diduga diturunkan dari sekuen common anchestor. Terdapat tiga metode dalam filogenetika yang
dibahas dalam makalah ini, yaitu: (1) Maximum parsimony, (2) Distance dan (3) Maximum likehoood yang secara umum
digunakan untuk membentuk pohon evolusi atau pohon terbaik untuk mengamati variasi sekuen dalam kelompok. Masingmasing metode ini digunakan untuk tipe analisis yang berbeda dan penggunaanya disesuaikan dengan bentuk dan jenis data yang
akan diolah.
Kata kunci: filogenetik, analisis, evolusi, sekuen nukleotida/protein
ABSTRACT
MOLECULAR PHYLOGENETIC: ORGANISM TAXONOMY METHOD BASED ON EVOLUTION HISTORY
Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny
and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic.
Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis
can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a
species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation
are referred as taxa (singular taxon) that is defined as phylogenetically distinct units on the tree. The tree consists of outer
branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence
from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods
which were used in phylogenetic, namely (1) Maximum parsimony, (2) Distance, and (3) Maximum likehoood. Those methods
generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method
is usually used for different analysis and data.
Key words: Phylogenetic, analysis, evolution, nucleotide/protein sequence
PENDAHULUAN
Filogenetika dikenal sebagai bidang yang
berkaitan dengan ilmu biologi. Filogenetika
menyediakan fasilitas dalam bidang epidemiologi
manusia, ekologi, dan evolusi biologi. Ketertarikan
peneliti menggunakan analisis filogenetika tidak jarang
membuat sedikit membingungkan dikarenakan
ketidakmengertian dalam menggunakan beberapa
metode dalam analisis filogenetika. Pertanyaan yang
sering muncul adalah metode analisis filogenetika
mana yang akan digunakan? Pohon filogenetika mana
yang bisa dipercaya? Pada makalah ini, penulis akan
memaparkan bagaimana memilih metode filogenetika
sesuai dengan data yang kita miliki untuk membuat
pohon filogenetika yang dapat dipercaya.
Analisis filogenetika tidak terlepas dari evolusi
biologis. Evolusi adalah proses gradual, suatu
organisme yang memungkinkan spesies sederhana
menjadi lebih komplek melalui akumulasi perubahan
dari beberapa generasi. Keturunan akan mempunyai
beberapa perbedaan dari nenek moyangnya sebab
1
WARTAZOA Vol. 21 No. 1 Th. 2011
sedang berubah dalam sebuah evolusi (ESTABROOK,
1984). Dalam mempelajari variasi dan diferensiasi
genetik antar populasi, jarak genetik dapat dihitung dari
jumlah perbedaan basa polimorfik suatu lokus gen
masing-masing populasi berdasarkan urutan DNA
(CAVALLI-SFORZA, 1997).
Analisis sistematika dilakukan melalui konstruksi
sejarah evolusi dan hubungan evolusi antara keturunan
dengan nenek moyangnya berdasarkan pada kemiripan
karakter sebagai dasar dari perbandingan (LIPSCOMB,
1998). Jenis analisis yang diketahui dengan baik adalah
analisis filogenetika atau kadang-kadang disebut
cladistics yang berarti clade atau kelompok keturunan
dari satu nenek moyang yang sama. Analisis
filogenetik biasanya direpresentasikan sebagai sistem
percabangan, seperti diagram pohon yang dikenal
sebagai pohon filogenetika (BRINKMAN dan LEIPE,
2001).
Dalam sistem biologis, proses evolusi melibatkan
mutasi genetik dan proses rekombinan dalam spesies
untuk membentuk spesies yang baru. Sejarah evolusi
organisme dapat diidentifikasi dari perubahan
karakternya. Karakter yang sama adalah dasar untuk
menganalisis hubungan satu spesies dengan spesies
lainnya (SCHMIDT, 2003). Pohon filogenetik adalah
pendekatan logis untuk menunjukkan hubungan evolusi
antara organisme (SCHMIDT, 2003). Filogenetika
diartikan sebagai model untuk merepresentasikan
sekitar hubungan nenek moyang organisme, sekuen
molekul atau keduanya (BRINKMAN and LEIPE., 2001).
Salah satu tujuan dari penyusunan filogenetika adalah
untuk mengkonstruksi dengan tepat hubungan antara
organisme dan mengestimasi perbedaan yang terjadi
dari satu nenek moyang kepada keturunannya (LI et al.,
1999).
Analisis filogenetika molekuler
Konstruksi pohon filogenetika adalah hal yang
terpenting dan menarik dalam studi evolusi. Terdapat
beberapa metode untuk mengkonstruksi pohon
filogenetika dari data molekuler (nukleotida atau asam
amino) (SAITOU dan IMANISHI, 1989). Analisis
filogenetika dari keluarga sekuen nukleotida atau asam
amino adalah analisis untuk menentukan bagaimana
keluarga tersebut diturunkan selama proses evolusi.
Hubungan evolusi diantara sekuen digambarkan
dengan menempatkan sekuen sebagai cabang luar dari
sebuah pohon. Hubungan cabang pada bagian dalam
pohon merefleksikan tingkat dimana sekuen yang
berbeda saling berhubungan. Dua sekuen yang sangat
mirip akan terletak sebagai neighboring outside dari
cabang-cabang dan berhubungan dalam cabang umum
(Common branch) (MOUNT, 2001).
Filogenetika digambarkan sebagai klasifikasi
secara taksonomi dari organisme berdasarkan pada
2
sejarah evolusi mereka, yaitu filogeni mereka dan
merupakan bagian integral dari ilmu pengetahuan yang
sistematik dan mempunyai tujuan untuk menentukan
filogeni dari organisme berdasarkan pada karakteristik
mereka. Lebih lanjut filogenetika adalah pusat dari
evolusi biologi seperti penyingkatan keseluruhan
paradigma dari bagaimana organisme hidup dan
berkembang di alam (MOUNT, 2001).
Analisis filogenetika sekuen asam amino dan
protein biasanya akan menjadi wilayah yang penting
dalam analisis sekuen. Selain itu, dalam filogenetika
dapat menganalisis perubahan yang terjadi dalam
evolusi organisme yang berbeda. Berdasarkan analisis,
sekuen yang mempunyai kedekatan dapat diidentifikasi
dengan menempati cabang yang bertetangga pada
pohon. Ketika keluarga gen ditemukan dalam
organisme atau kelompok organisme, hubungan
filogenetika diantara gen dapat memprediksikan
kemungkinan yang satu mempunyai fungsi yang
ekuivalen. Prediksi fungsi ini dapat diuji dengan
eksperimen genetik. Analisis filogenetika juga
digunakan untuk mengikuti perubahan yang terjadi
secara cepat yang mampu mengubah suatu spesies,
seperti virus (MCDONALD dan KREITMAN, 1991;
NIELSEN dan YANG, 1998).
Hubungan analisis filogenetika dengan
alignment/penjejeran sekuen
Ketika sekuen nukleotida atau protein dari dua
organisme yang berbeda memiliki kemiripan, maka
mereka diduga diturunkan dari sekuen common
ancestor. Sekuen penjejeran akan menunjukkan dimana
posisi sekuen adalah tidak berubah/conserved dan
dimana merupakan divergent/atau berkembang menjadi
berbeda dari common ancestor seperti diilustrasikan
MOUNT (2001) pada ilustrasi di bawah ini. Sekuen 1
dan 2 diasumsikan berasal dari nenek moyang yang
sama (common ancestor). Total terdapat dua sekuen
yang berubah.
GAATC
GA(A/G)T(C/T)
Sekuen nenek moyang
GAGTT
Studi sekuen biologi selalu tidak dapat
dihindarkan dari penjejeran sekuen/alignment. Tujuan
dari proses penjejeran adalah mencocokkan karakterkarakter yang homolog, yaitu karakter yang
mempunyai nenek moyang yang sama (KEMENA dan
NOTREDAME, 2009). Ketika menghomologikan sekuen,
kolom dari penjejeran dapat digunakan untuk berbagai
macam aplikasi seperti mengidentifikasi residu dengan
struktur yang analog atau yang mempunyai fungsi
N.L.P. INDI DHARYAMANTI: Filogenetika Molekuler: Metode Taksonomi Organisme Berdasarkan Sejarah Evolusi
yang serupa atau untuk mengkonstruksi pohon
filogenetika. Akurasi dari program penejejeran sekuen
ynag lebih dari dua set/multiple sequence alignment
telah dihasilkan oleh berbagai macam studi komperatif
(BLACKSHIELDS et al., 2006; EDGAR dan BATZOGLOU
2006; NOTREDAME, 2007).
Metode paling umum dalam melakukan multiple
sequence alignment adalah pertama melakukan
penjejeran kelompok sekuen yang mempunyai
hubungan dekat dan kemudian secara sekuensial
ditambahkan sekuen yang berhubungan namun lebih
berbeda. Penjejeran yang diperoleh diakibatkan karena
sebagian besar sekuen yang mirip dalam kelompok
sehingga tidak merepresentasikan sejarah yang
sesungguhnya dari perubahan evolusi yang telah
terjadi. Sebagian besar metode analisis filogenetika
mengasumsikan bahwa masing-masing posisi sekuen
protein atau asam nukleat yang berubah secara
independen satu sama yang lain (kecuali evolusi sekuen
RNA).
Seperti yang telah ditunjukkan sebelumnya,
analisis sekuen yang sangat mirip dan mempunyai
panjang yang sama adalah sangat jelas. Seringkali hasil
penjejeran sekuen memperlihatkan adanya gap dalam
penjejeran tersebut. Gap menunjukkan adanya insersi
atau delesi dari satu atau lebih dari karakter sekuen
selama evolusi. Protein yang dijejerkan semestinya
mempunyai struktur tiga dimensi yang sama.
Umumnya, sekuen dalan struktur core seperti protein
tidak mengalami insersi atau delesi dikarenakan
subtitusi asam amino harus cocok dengan lingkungan
paket hidrofobik dari core. Gap sangat jarang
ditemukan pada multiple sequence alignment yang
menunjukkan sekuen core. Sebaliknya, beberapa
variasi termasuk insersi, delesi sangat mungkin
ditemukan di daerah loop pada bagian luar struktur tiga
dimensi, sebab pada bagian ini tidak berpengaruh
banyak terhadap struktur core. Daerah loop berinteraksi
dengan molekul kecil, membran dan protein lain di
lingkungan (MOUNT, 2001).
Gap
dalam
penjejeran
merepresentasikan
perubahan mutasi dalam sekuen termasuk insersi,
delesi atau penyusunan ulang materi genetik.
Ekspektasi bahwa panjang gap dapat terjadi sebagai
akibat adanya introduksi tunggal yang memutuskan
berapa banyak perubahan individu telah terjadi dan apa
perintahnya. Gap diberi perlakuan (treated) dalam
beberapa program filogenetik, tetapi tidak ada clear-cut
model seperti bagaimana seharusnya mereka di
perlakukan. Beberapa metode mengabaikan gap yang
terjadi atau hanya memfokuskan dalam penjejeran yang
tidak mempunyai gap. Meskipun gap dapat berguna
sebagai petanda filogenetik di beberapa situasi.
Pendekatan lainnya untuk menangani gap adalah
mencegah analisis situs individu dalam penjejeran
sekuen, dan menggantikan dengan menggunakan
skoring kemiripan/similarity score sebagai dasar dari
analisis filogenetika.
Konsep pohon evolusi
Pohon evolusi adalah sebuah grafik dua dimensi
yang menunjukkan hubungan diantara organisme atau
lebih spesifik lagi adalah sekuen gen dari organisme.
Pemisahan sekuen disebut taxa (atau taxon jika
tunggal) yang didefinisikan sebagai jarak filogenetika
unit pada sebuah pohon. Pohon terdiri dari cabangcabang luar (outer branches) atau daun-daun (leaves)
yang merepresentasikan taxa dan titik-titik (nodes) dan
cabang merepresentasikan hubungan diantara taxa,
yang diilustrasikan sebagai A-D pada Gambar 1.
Gambar 1. Struktur pohon evolusi
Sumber: MOUNT (2001)
Oleh karena itu, sekuen A dan B dipisahkan dari
sekuen common ancestor yang direpresentasikan
dengan titik-titik di bawahnya; C dan D adalah
mempunyai kemiripan. Pada Gambar 1 menunjukkan
bahwa sekuen A/B dan C/D memiliki common
ancestor yang sama yang ditunjukkan dengan sebuah
titik pada bagian paling rendah dari pohon. Hal ini
sangat penting untuk mengenali bahwa masing-masing
titik dalam pohon direpresentasikan sebuah pemisahan
garis evolusi gen ke dalam dua spesies yang berbeda.
Panjang masing-masing cabang pada titik berikutnya
menunjukkan jumlah sekuen yang berubah yang terjadi
sebelum level pemisahannya. Contohnya, panjang
cabang antara titik A/B dan B menunjukkan spesies
mempunyai rata-rata evolusi yang sama.
Total panjang semua cabang dalam pohon disebut
sebagai panjang pohon. Pohon yang juga bercabang
3
WARTAZOA Vol. 21 No. 1 Th. 2011
dua atau binary tree, mempunyai dua cabang yang
berasal dari masing-masing titik. Situasi ini adalah satu
dari yang diperkirakan selama evolusi, dan hanya
memisahkan spesies baru pada waktu itu. Pohon dapat
mempunyai lebih dari satu cabang yang berasal dari
sebuah titik jika pemisahan taxa juga sedemikian dekat
sehingga mereka tidak dapat dipecahkan atau menjadi
pohon yang sederhana.
Representasi alternatif dari hubungan sekuen
diantara A-D pada Gambar 1A ditunjukkan pada
Gambar 1B. Perbedaan diantara pohon A dan B yaitu
pohon B adalah unrooted tree. Unrooted tree juga
menunjukkan hubungan evolusi diantara sekuen A-D,
tetapi tidak menyatakan lokasi dari moyang yang
tertua/oldest ancestry. Sebagai contoh, B dapat diubah
menjadi A dengan menempatkan titik yang lain dan
menghubungkan root pada A dan B. Root dapat juga
ditempatkan dimana saja dalam pohon. Jadi terdapat
beberapa besar kemungkinan untuk rooted daripada
unrooted untuk memberikan sejumlah taxa atau
sekuen.
Dalam mengkonstruksi pohon filogenetika dapat
diklasifikasikan menjadi 2 kategori yang digunakan
sebagai strategi untuk menghasilkan pohon filogenetika
terbaik. Kategori pertama adalah memeriksa semua
atau sejumlah besar kemungkinan pohon filogenetika
dan memilih satu yang terbaik dengan kriteria-kriteria
tertentu. Biasanya disebut dengan metode exhaustivesearch. Metode maximum parsimony, Fitch Margoliash
dan maximum likehood termasuk dalam kategori ini.
Kategori yang kedua adalah memeriksa hubungan
topologi lokal dari pohon dan mengkonstruksi pohon
terbaik dengan langkah demi langkah. Metode
Neighbor-joining dan beberapa metode Distance
lainnya adalah termasuk dalam kategori yang kedua ini
(SAITOU dan IMANISHI, 1989). Dalam makalah ini akan
dibahas tiga metode saja yaitu: (1) Maximum
parsimony, (2) Distance dan (3) Maximum likehoood
yang secara umum digunakan untuk membentuk pohon
evolusi atau pohon terbaik untuk mengamati variasi
sekuen dalam kelompok. Masing-masing metode ini
digunakan untuk tipe analisis yang berbeda (MOUNT,
2001).
Metode maximum parsimony
Parsimony atau metode minimum evolution
pertama kali digunakan dalam filogenetik oleh Camin
and Sokal pada tahun 1965 (FELSENSTEIN, 1978).
Metode ini memprediksikan pohon
evolusi/
evolutionary tree yang meminimalkan jumlah langkah
yang dibutuhkan untuk menghasilkan variasi yang
diamati dalam sekuen. Untuk alasan ini, metode ini
juga sering disebut sebagai metode evolusi
minimum/minimum evolution method. Sebuah multiple
sequence alignment dibutuhkan untuk memprediksi
4
posisi sekuen yang sepertinya berhubungan. Posisi ini
akan menampilkan kolom vertikal dalam multiple
sequence alignment. Untuk masing-masing posisi yang
disejajarkan, pohon filogenetika membutuhkan
perubahan evolusi dalam jumlah terkecil untuk
menghasilkan pengamatan perubahan sekuen yang
diidentifikasi. Analisis ini terus menerus dilakukan
terhadap masing-masing posisi dalam penjejeran
sekuen. Akhirnya, pohon yang menghasilkan jumlah
perubahan terkecil secara keseluruhan dihasilkan untuk
semua posisi sekuen yang diidentifikasi. Metode ini
berguna untuk sekuen yang mirip dan dalam jumlah
yang sedikit. Alogaritma yang digunakan tidak rumit
tetapi dijamin untuk dapat menemukan pohon yang
terbaik, sebab semua kemungkinan pohon yang
dibentuk berhubungan dengan kelompok sekuen yang
diperiksa. Untuk alasan ini, metode ini cukup
membutuhkan banyak waktu dan tidak berguna untuk
data sekuen dalam jumlah besar dan asumsi lain harus
dibuat untuk root pohon yang diprediksikan.
Metode jarak/distance method
Metode jarak bekerja pada jumlah perubahan
diantara masing-masing pasangan dalam kelompok
untuk mengkonstruksi pohon filogenetika dalam
kelompok. Pasangan sekuen yang mempunyai jumlah
perubahan terkecil diantara mereka disebut neighbors.
Pada pohon, sekuen-sekuen ini menggunakan secara
bersama-sama satu titik atau posisi common ancestor
dan masing-masing dihubungkan titik oleh sebuah
cabang. Tujuan dari metode jarak adalah metode untuk
mengidentifikasi pohon pada posisi neighbors dengan
benar, dan juga mempunyai cabang yang menghasilkan
data orisinil sedekat mungkin. Penemuan neighbors
terdekat diantara kelompok sekuen dengan metode
jarak biasanya langkah pertama dalam memproduksi
sebuah multiple sequence alignment.
Metode jarak pertama kali ditemukan oleh Feng
dan Doolitle; pengelompokan program oleh penulis
tersebut menghasilkan sebuah penjejeran dan pohon
dari set sekuen protein (FENG dan DOOLITLE, 1996).
Program CLUSTALW, digunakan untuk neighborjoining distance method sebagai panduan untuk
multiple sequence alignment. Program PAUP versi 4
merupakan pilihan untuk membentuk sebuah analisis
filogenetika dengan distance method. Program
PHYLIP package yang membentuk analisis distance
termasuk program yang secara otomatis dibaca dalam
sekuen dalam PHYLIP infile format dan secara
otomatis menghasilkan file yang disebut dengan tabel
distance.
Dalam pengukuran jarak genetik menggunakan
model substitusi nukleotida, suatu sekuen DNA akan
dibandingkan satu nukleotida dengan nukleotida
lainnya. Jarak ini dapat mengukur suatu sekuen
N.L.P. INDI DHARYAMANTI: Filogenetika Molekuler: Metode Taksonomi Organisme Berdasarkan Sejarah Evolusi
nukleotida baik yang menyandi protein maupun tidak.
Pada jarak matrik (distance matrices) yang dihasilkan,
mereka mungkin digunakan sebagai input yang
mengikuti program analisis jarak dalam PHYLIP.
Program PHYLIP semua secara otomatis membaca
input file yang disebut infile dan menghasilkan sebuah
outfile. Jadi, nama file harus diedit ketika menggunakan
program ini. Sebagai contoh, distance outfile harus
diedit untuk memasukkan hanya tabel distance dan
jumlah taxa, dan ketika file disimpan dengan nama
sekuen infile. Analisis distance dalam program
PHYLIP adalah sebagai berikut:
1. FITCH mengestimasi sebuah pohon filogenetika
yang mengasumsikan penambahan panjang cabang
menggunakan metode Fitch-Margoliash dan tidak
mengasumsikan sebuah molecular clock (mengikuti
rata-rata evolusi sepanjang cabang yang bervariasi).
2. KITCH
mengestimasikan
sebuah
pohon
filogenetika
tetapi
dengan
mengasumsikan
molecular clock.
3. NEIGHBOR mengestimasi pohon filogenetika
menggunakan neighbor joining atau metode
unweighted pair group dengan rata-rata aritmatika
(UPGMA). Metode neighbor joining tidak
mengasumsi molecular clock dan meghasilkan
unrooted tree.
Metode UPGMA mengasumsikan sebuah
molecular clock dan rooted tree. Metode ini secara
normal menghitung skor similaritas yang didefinisikan
sebagai jumlah total dari jumlah sekuen yang identik
dan jumlah substitusi konservatif dalam penjejeran dua
sekuen dengan gap yang diabaikan. Skor identitas
antara sekuen menunjukkan hanya identitas yang
mungkin ditemukan dalam penjejeran. Untuk analisis
filogenetik digunakan skor jarak antara dua sekuen.
Skor diantara dua sekuen adalah jumlah posisi yang
tidak cocok/mismatch dalam penjejeran atau jumlah
posisi sekuen yang harus diubah untuk menghasilkan
sekuen yang lain. Gap mungkin diabaikan dalam
kalkulasi atau diberi perlakuan seperti substitusi.
Ketika sebuah skoring atau matrik substitusi
digunakan, kalkulasi menjadi lebih komplek tetapi
secara prinsip tetap sama.
Metode Fitch dan Margoliash
Metode FITCH dan MARGOLIASH (1987)
menggunakan tabel yang diilustrasikan seperti pada
Gambar 2. Sekuen-sekuen dikombinasi dalam tiga
untuk mendefinisikan cabang-cabang pohon yang
diprediksikan dan untuk menghitung panjang-panjang
cabang dari pohon. Ini adalah metode averanging
distance merupakan metode yang paling akurat untuk
pohon dengan cabang yang pendek. Adanya cabang
yang panjang bertendensi menurunkan tingkat
kepercayaan dari prediksi (SWOFFORD et al., 1996).
A. Sequence
Sequence A
Sequence B
Sequence C
Sequence D
ACGCGTTGGGCGATGGCAAC
ACGCGTTGGGCGACGGTAAT
ACGCATTGAATGATGATAAT
ACACATTGAGTGATAATAAT
B. Distance between sequences, the number of
steps required to change one sequence into
the other
nAB 3
nAC 7
nAD 8
nBC 6
nBD 7
nCD 3
C. Distance table
A
A
B
C
D
-
B
3
-
C
7
6
-
D
8
7
3
-
D. The assumed phylogenetic tree for the
sequences A-D showing branch lengths.
The sum of the branch lengths between any
two sequences on the trees has the same
value as the distance between the sequences
A
B
1
2
4
1
C
2
D
Gambar 2. Kelompok sekuen yang ideal dengan panjang
cabang pohon yang diasumsikan
Sumber: MOUNT (2001)
Metode neighbor - joining (NJ)
Metode neighbor-joining sangat mirip dengan
metode Fitch dan Margoliash kecuali tentang pemilihan
sekuen untuk berpasangan ditentukan oleh perbedaan
alogaritma. Metode neighbor-joining sangat cocok
ketika rata-rata evolusi dari pemisahan lineage adalah
di bawah pertimbangan yang berbeda-beda. Ketika
panjang cabang dari pohon yang diketahui topologinya
berubah dengan cara menstimulasi tingkat yang
bervariasi dari perubahan evolusi, metode neighborjoining adalah yang paling cocok untuk memprediksi
pohon dengan benar (SAITOU dan MEI, 1987).
Neighbor-joining memilih sekuen yang jika
digabungkan akan memberikan estimasi terbaik dari
panjang cabang yang paling dekat merefleksikan jarak
yang nyata diantara sekuen. Pada Gambar 4
menunjukkan pohon filogenetika yang dikonstruksi
dengan metode Neighbor-joining.
5
WARTAZOA Vol. 21 No. 1 Th. 2011
Metode unweighted pair group dengan rata-rata
aritmetika (UPGMA)
sekuen pada masing-masing situs menjadi lebih
komplek dan menjadi sulit untuk memprediksi.
Metode jarak yang telah diuraikan di atas
memberikan sebuah estimasi yang baik dari sebuah
pohon evolusi dan tidak terpengaruh oleh variasi dalam
rata-rata perubahan sepanjang cabang dari pohon.
Metode UPGMA adalah metode sederhana untuk
konstruksi pohon yang mengasumsikan rata-rata
perubahan sepanjang pohon adalah konstan dan
jaraknya kira-kira ultrameric (ultrameric biasanya
diekspresikan sebagai molecular clock tree). Metode
UPGMA dimulai dengan kalkulasi panjang cabang
diantara sekuen paling dekat yang saling berhubungan,
kemudian rata-rata jarak antara sekuen ini atau
kelompok sekuen dan sekuen berikutnya atau
kelompok sekuen dan berlanjut sampai semua sekuen
yang termasuk dalam pohon. Akhirnya metode ini
memprediksi posisi root dari pohon.
Pemilihan Outgroup
Jika kita ingin secara independen mendapatkan
informasi yang meyakinkan dari sekuen lebih
berhubungan, sebuah prosedur dapat diikuti dengan
menambahkan sekuen pada pohon dan yang paling
dekat dengan root. Modifikasi dapat meningkatkan
prediksi dari pohon dengan metode di atas yaitu dengan
menambahkan outgroup pada langkah akhir dari
prosedur. Satu atau lebih sekuen jenis ini disebut
sebagai outgroup. Sebagai contoh, sekuen A dan B
berasal dari spesies yang telah diketahui terpisah satu
dengan yang lain pada awal evolusi berdasarkan
catatan fosil. A dan B kemudian diperlakukan sebagai
outgroup. Pemilihan satu atau lebih outgroup dengan
distance method dapat juga membantu dengan
lokalisasi root dari pohon (SWOFFORD et al., 1996).
Root akan ditempatkan diantara outgroup dan titik yang
menghubungkan sekuen. Sekuen dari outgroup
semestinya berkorelasi dekat dengan sekuen-sekuen
yang dianalisa, tetapi juga mempunyai perbedaan yang
signifikan antara outgroup dengan sekuen yang lain
daripada diantara sekuen itu sendiri (Gambar 3).
Pemilihan sekuen outgroup yang terlalu jauh
kemungkinan akan berperanan terhadap prediksi pohon
menjadi salah akibat terdapat pebedaan yang secara
random yang lebih banyak diantara sekuen outgroup
dengan sekuen lainnya (LI dan GRAUR, 1991 dalam
MOUNT, 2001). Perubahan multiple sequence pada
masing-masing situs menjadi lebih mungkin dan akan
lebih komplek untuk genetic rearrangements yang
komplek. Untuk alasan yang sama, menggunakan
sekuen yang terlalu berbeda dalam metode jarak dari
prediksi filogenetik dapat berperanan terhadap
kesalahan yang terjadi (SWOFFORD et al., 1996).
Jumlah perbedaan yang meningkat, perubahan histori
6
Gambar 3. Pohon filogenetika DNA Maximum Likehood
sekuen hemagglutinin H7 virus Avian Influenza
H7 low pathogenic
Sumber: MUNSTER et al. (2005)
Pendekatan maximum likehood
Metode ini menggunakan kalkulasi untuk
menemukan pohon yang mempunyai hitungan variasi
terbaik dalam set sekuen. Metode ini mirip dengan
metode maximum parsimony dalam analisis yang
dibentuk pada masing-masing kolom dalam multiple
sequence alignment. Semua kemungkinan pohon yang
terbentuk dipertimbangkan, sehingga metode ini hanya
cocok untuk sekuen dalam jumlah kecil. Metode ini
mempertimbangkan untuk masing-masing pohon,
jumlah perubahan sekuen atau mutasi yang terjadi yang
memberikan variasi sekuen. Metode maximum likehood
menampilkan
kesempatan
penambahan
untuk
mengevaluasi pohon dengan variasi dalam rata-rata
mutasi dalam lineage yang berbeda. Metode ini dapat
digunakan untuk mengekplorasi hubungan antara
N.L.P. INDI DHARYAMANTI: Filogenetika Molekuler: Metode Taksonomi Organisme Berdasarkan Sejarah Evolusi
sekuen yang lebih beragam, dimana kondisi ini tidak
dapat dilakukan dengan baik jika menggunakan metode
maximum persimony. Kekurangan metode maximum
likehood adalah membutuhkan pekerjaan komputer
yang sangat intensif. Jika menggunakan komputer yang
lebih cepat, metode maximum likehood dapat
digunakan untuk model evolusi yang lebih komplek.
Metode ini juga dapat digunakan untuk menganalisa
mutasi pada overlapping reading frame pada virus
(SCHADT et al., 1998). Pada Gambar 3 adalah sebagai
contoh dari pohon filogenetika dengan menggunakan
maximum likehood.
Prediksi filogenetik yang dipercaya
Analisis filogenetika set sekuen yang menjejerkan
dengan baik adalah jelas sebab posisi yang bertanggung
jawab dalam sekuen dapat diidentifikasi dalam multiple
sequence alignment dari sekuen. Tipe perubahan dalam
penjejeran posisi atau jumlah yang berubah dalam
penjejeran antara pasangan sekuen menyediakan dasar
untuk menentukan hubungan filogenetika diantara
sekuen berdasarkan metode analisis filogenetika.
Penentuan perubahan sekuen yang telah terjadi menjadi
sulit sebab multiple sequence alignment mungkin tidak
optimal dan sebab perubahan yang banyak terjadi pada
penjejeran posisi sekuen. Pilihan metode multiple
sequence alignment tergantung pada tingkat variasi
diantara sekuen. Jika penjejeran yang cocok telah
ditemukan, pertanyaannya adalah bagaimana prediksi
filogenetika didukung oleh data dalam multiple
sequence alignment.
Dalam metode bootstrap, data dilakukan
resampled, dengan secara random memilih kolom
vertikal dari sekuen yang dijejerkan untuk
menghasilkan penjejeran, dan dalam pengaruh sebuah
penjejeran baru dengan panjang yang sama. Masingmasing kolom digunakan lebih dari satu kali dan
beberapa kolom mungkin tidak digunakan pada semua
penjejeran yang baru. Pohon-pohon kemudian
diprediksi dari beberapa penjejeran ini dari resampled
sekuen (FELSENSTEIN, 1988). Untuk cabang-cabang
dalam topologi filogenetika yang diprediksi menjadi
signifikan jika set data resampled seharusnya
berulangkali (sebagai contoh > 70%) memprediksi
cabang-cabang yang sama.
Analisis bootstrap adalah metode yang menguji
seberapa baik set data model. Sebagai contoh validitas
penyusunan cabang dalam prediksi pohon filogenetik
dapat diuji dengan resampled dari kolom dalam
multiple sequence alignment untuk membentuk
beberapa penjejeran baru. Penampakan cabang dalam
pohon dari sekuen resampled ini dapat diukur.
Alternatifnya, sekuen kemungkinan harus dikeluarkan
dari analisis untuk menentukan berapa banyak sekuen
yang mempengaruhi hasil dari analisis. Bootstrap
analysis didukung oleh sebagian besar paket software
menguji cabang-cabang yang dapat dipercaya.
Sebagai contoh bagaimana analisis filogenetik
dibuat, dapat dilihat pada Gambar 4.
Gambar 4 adalah sebuah pohon filogenetika
molekuler yang disusun dari urutan sekuen nukleotida
pada gen Matrix dari organisme virus Avian Influenza
virus H5N1. Nilai boostrap ditunjukkan pada angka
yang terletak pada cabang-cabang pohon filogenetika
(tanda panah). Grup 2 yaitu kelompok gen Matrix dari
virus influenza asal Hong Kong dan China yang
digunakan sebagai outgroup dari keseluruhan analisis
filogenetik pada Gambar 3, Grup 2 dan grup 1
merupakan virus influenza yang sama yang mempunyai
kemiripan dengan virus influenza asal Indonesia
sehingga sebagai outgroup, Grup 2, berkorelasi dekat
dengan sekuen-sekuen yang dianalisis, tetapi juga
mempunyai perbedaan yang signifikan antara outgroup
dengan sekuen yang lain daripada diantara sekuen itu
sendiri.
Jarak genetik berdasarkan metode algoritma
pembentukan pohon akan menampilkan data berupa
pohon filogenetika. Pohon filogenetika memberi
informasi
tentang
pengklasifikasian
populasi
berdasarkan
hubungan
evolusionernya.
Dalam
rekontruksi pohon filogenetika, data molekul lebih
banyak dipakai karena dianggap lebih stabil dalam
proses evolusi dibandingkan dengan data morfologi.
Pohon filogenetika dapat berakar (rooted) atau tidak
berakar (unrooted), tergantung metode analisis yang
dipergunakan. Akar pada pohon menggambarkan titik
percabangan pertama atau asal masing-masing populasi
dengan asumsi bahwa laju evolusi berjalan konstan
(NEI, 1987). Pola percabangan pohon dibentuk
berdasarkan jarak matrik antar pasangan populasi yang
dapat menggambarkan fusi genetik yang terjadi pada
kelompok tersebut (WEISS, 1995). Panjang cabang
menggambarkan jumlah substitusi basa yang dapat
berupa polimorfisme DNA atau haplotipe. Metode
pengolahan data yang digunakan harus sesuai dengan
set data yang ada, agar dapat menghasilkan pola
percabangan (topologi) serta panjang cabang yang
benar (CAVALLI-SFORZA, 1997). Topologi pohon yang
salah akan mengakibatkan panjang cabang yang salah
dan pohon secara keseluruhan tidak memberi informasi
genetik apapun. Semua metode diatas mempunyai
keunggulan dan kelemahan masing-masing, sehingga
penggunaannya disesuaikan dengan bentuk dan jenis
data yang akan diolah. Metode yang paling sering
digunakan adalah metode Neighbor-Joining (NJ).
Metode NJ merupakan metode yang disederhanakan
dari metode minimum evolution (ME).
Untuk
memperkecil
kesalahan
dalam
mengkonstruksi pohon filogenetika dapat dilakukan
sampling ulang dengan petanda genetik lain pada
sampel yang sama dan kemudian membandingkan
7
WARTAZOA Vol. 21 No. 1 Th. 2011
A/Ck/W est Java/Smi-Acul/2008
A/Ck/Banten/Srg-Fadh/2008
A/Indonesia/CDC1032/2007
A/Indonesia/CDC938/2006
A/Indonesia/CDC887/2006
66 A/Muscovyduck/W est Java/Bks3/2007
66
A/Indonesia/CDC1031/2007
A/Ck/Pessel/BPPVRII/2007
87 A/C k/Inhu/BPPVRII/2007
A/Indonesia/245H /2005
A/Indonesia/CDC292T/2005
65
A/Indonesia/CDC287E/2005
73
A/Indonesia/304H /2006
A/Indonesia/CDC582/2006
A/Indonesia/567H /2006
A/Indonesia/239H /2005
A/Indonesia/CDC523/2006
A/Indonesia/CDC644/2006
A/Indonesia/CDC634/2006
A/Indonesia/CDC699/2006
A/Indonesia/604H /2006
A/Indonesia/CDC940/2006
A/feline/Indonesia/CDC1/2006
A/Indonesia/CDC836/2006
A/Indonesia/CDC739/2006
A/Indonesia/CDC669/2006
A/Indonesia/283H /2006
A/Indonesia/583H /2006
A/Indonesia/CDC759/2006
A/Indonesia/CDC329/2006
A/Indonesia/CDC610/2006
A/Indonesia/292H /2006
A/Indonesia/CDC326/2006
A/Indonesia/542H /2006
A/Muscovyduck/Jakarta/Sum106/2006
A/Duck/Jakarta/Slmt306/2006
A/Indonesia/CDC357/2006
A/Indonesia/6/2005
A/Ck/Jakarta/DKI-Nurs/2007
A/Indonesia/CDC1046/2007
A/Indonesia/CDC1047/2007
A/Ck/W est Java/Smi-Hj18/2007
81
A/Ck/W est Java/Smi-Sud1/2007
A/Ck/W est Java/SMI-M1/2008
A/Ck/W est Java/SMI-M6/2008
A/C k/W est Java/SMI-Biot/2008
A/chicken/Salatiga/BBVetI/2005
A/chicken/Simalanggang/BPPVI/2005
A/chicken/D airi/BPPVI/2005
A/chicken/T ebing Tinggi/BPPVI/2005
A/chicken/T arutung/BPPVI/2005
A/chicken/D eli Serdang/BPPVI/2005
A/Indonesia/536H /2006
A/Indonesia/CDC594/2006
A/Indonesia/CDC625L/2006
A/Indonesia/CDC625/2006
A/Indonesia/535H /2006
A/Indonesia/546bH/2006
A/Indonesia/534H /2006
65 A/Indonesia/546H /2006
A/Indonesia/CDC597/2006
A/Indonesia/538H /2006
A/Indonesia/CDC599/2006
A/Indonesia/CDC595/2006
A/Indonesia/560H /2006
A/Indonesia/CDC596/2006
A/chicken/Pangkalpinang/BPPV3/2004
A/turkey/Kedaton/BPPV3/2004
A/C k/Indonesia/2A/2003
97 A/chicken/Malang/BBVetIV/2004
A/chicken/Purwakarta/BBVetIV/2004
A/chicken/Kulon Progo/BBVW /2005
A/Ck/Jakarta/DKI31/2005
A/chicken/Kupang1NTT/BPPV6/2004
A/Indonesia/160H /2005
A/Indonesia/CDC184/2005
A/Indonesia/298H /2006
A/chicken/Indonesia/CDC 25/2005
A/Muscovyduck/Bgr-C w/2005
A/chicken/Indonesia/CDC 24/2005
A/duck/Parepare/BBVM/2005
A/chicken/G unung Kidal/BBVW /2005
A/chicken/Magetan/BBVW /2005
A/chicken/W ajo/BBVM/2005
A/Indonesia/5/2005
A/Ck/W est Java/Smi-H ay/2005
A/Indonesia/CDC7/2005
A/Indonesia/7/2005
65 A/Indonesia/175H /2005
A/Indonesia/CDC194P/2005
A/Indonesia/CDC370/2006
A/Indonesia/CDC624/2006
A/Indonesia/CDC390/2006
A/Indonesia/CDC623/2006
62 A/Indonesia/569H /2006
A/Indonesia/321H /2006
A/Indonesia/341H /2006
A/chicken/MangaraiNTT/BPPV6/2004
A/chicken/N gawi/BPPV4/2004
A/chicken/Bantul/BBVetI/2005
A/Ck/W est Java/1074/2003
A/chicken/Bangli Bali/BPPV62/2004
A/C k/W est Java/Bl-Ipa/2005
A/Muscovyduck/Jakarta/D KI-U wit/2004
A/quail/Yogjakarta/BBVetIX/2004
A/chicken/Sragen/BPPV4/2003
A/chicken/Bangli Bali/BBPV61/2004
A/chicken/W onosobo/BPPV4/2003
A/C k/Indonesia/5/2004
A/chicken/Jembrana/BPPV6/2004
A/chicken/Yogjakarta/BBVetIX/2004
A/D k/Indonesia/MS/2004
A/chicken/Kupang2NTT/BPPV6/2004
A/C k/Indonesia/BL/2003
A/chicken/Indonesia/11/2003
A/goose/Yunnan/3644/2005
A/quail/Boyolali/BPPV4/2004
A/quail/T asikmalaya/BPPV4/2004
A/C k/Indonesia/4/2004
A/chicken/Pekalongan/BPPV4/2003
A/C k/Indonesia/PA/2003
A/chicken/Kulon Progo/BBVetXII1/2004
84 A/chicken/Kulon Progo/BBVetXII2/2004
A/chicken/Purworejo/BBVW /2005
A/Duck/Banten/Pdgl-Kas/2004
A/G oose/G uangdong/1/96
A/H ong Kong/483/1997
A/H ong Kong/156/97
100 A/H ong Kong/481/97
66 A/H ong Kong/532/97
A/H ong Kong/542/97
A/H ong Kong/486/97
64
A/H ong Kong/482/97
95 A/H ong Kong/538/97
A/H ongKong/97/98
70
Grup 1,Virus
H5N1
Indonesia
Grup 2, Virus
asal China dan
Hong Kong
0.01
Gambar 4. Pohon filogenetik gen M2 virus AI asal unggas di sekitar kasus H5N1 pada manusia. Grup 1 merupakan kelompok
virus H5N1 asal Indonesia dan Grup 2 adalah virus asal China/Hong Kong sebagai outgroup. Kontruksi filogenetik
menggunakan metode neighbor-joining dan analisis bootstrap (1.000 replicates) menggunakan model Kimura-Nei
dalam software MEGA 4
Sumber: DHARMAYANTI et al. (2010)
8
N.L.P. INDI DHARYAMANTI: Filogenetika Molekuler: Metode Taksonomi Organisme Berdasarkan Sejarah Evolusi
kedua bentuk pohon tersebut. Akan tetapi tindakan
tersebut membutuhkan biaya besar sehingga hampir
tidak mungkin dilakukan. Sebagai gantinya EFRON
(1979) memperkenalkan metode sampling ulang
(resampling) dari data yang telah ada yang dikenal
dengan analisis bootstrap untuk menguji validitas
konstruksi pohon filogenetika.
KESIMPULAN
Pentingnya pemahaman bagaimana mengggunakan
analisis filogenetika khususnya filogentika molekuler
yang berasal dari data nukleotida atau asam amino
sangat berperanan dalam pembuatan pohon filogenetik
terbaik dan dapat dipercaya. Metode filogenetika yang
telah dibahas dalam makalah ini digunakan untuk tipe
analisis yang berbeda. Nilai bootstrap merupakan
untuk menguji seberapa baik set data model yang kita
gunakan. Jika nilai bootstrap rendah maka sekuen
seharusnya dikeluarkan dari analisis untuk mendapatkan
sebuah pohon filogenetika yang dapat dipercaya.
DAFTAR PUSTAKA
BLACKSHIELDS, G., I.M. WALLACE, M. LARKIN and D.G.
HIGGINS. 2006. Analysis and comparison of
benchmarks for multiple sequence alignment. Silico
Biol. 6: 321 – 339.
BRINKMAN, F. and D. LEIPE. 2001. Phylogenetic Analysis. In:
Bioinformatics: A Practical Guide to the Analisys of
Gene and Protein. BAXEVANIS, A.D. and B.F.F.
OUELLETTE (Eds.). John Willey & Sons. pp. 323 –
358.
CAVALLI-SFORZA, L.L. 1997. Genes, Peoples and Languages.
Proc. Natl. Acad. Sci. USA. 94(15): 7719 – 7724.
DHARMAYANTI, N.L.P.I., F. IBRAHIM and A. SOEBANDRIO.
2010. Amantadine resistant of Indonesian influenza
H5N1 subtype virus during 2003 – 2008. Microbiol
Indones. 5(1): 11 – 16.
EDGAR, R.C. and S. BATZOGLOU. 2006. Multiple sequence
alignment. Curr. Opin. Struct. Biol. 6: 368 – 373.
EFRON, B. 1979. Bootstrap Methods: Another Look at the
Jackknife. Ann. Statist. 7(1): 1 – 26.
ESTABROOK, G. 1984. Phylogenetic trees and character-state
trees. In: Perspectives on the Reconstruction
Evolutionary History Cladistics. DUNCAN, T. and T.
STUESSY (Eds.). Columbia University Press. pp. 135 –
151.
FELSENSTEIN, J. 1978. Cases in which Parsimony or
Compatibility Methods will be positively misleading.
Systematic Zoology 27(4): 401 – 410.
FELSENSTEIN, J. 1988. Phylogenies from molecular
sequences: Inferences and realibility. Annu. Rev.
Genet. 22: 521 – 565.
FENG, D.F. and R.F. DOOLITTLE. 1996. Progressive alignment
of amino acid sequences and construction of
phylogenetic trees from them. Methods Enzymol.
266: 368 – 382.
FITCH, W.M. and E. MARGOLIASH. 1987. Construction of
phylogenetic trees. Science. 155: 279 – 284.
KEMENA, C. and C. NOTREDAME. 2009. Upcoming challenges
for multiple sequence alignment methods in the highthroughput era. Bioinformatics. 25: 2455 – 2465.
LI, S., D. PEARL and H. DOSS. 1999. Phylogenetic tree
construction using Markov Chain Monte Carlo. Fred
Hutchinson Cancer Research Center Washington.
http://www.stat.ohio-state.edu/~doss/Research/mctrees.pdf. (23 Januari 2011).
LIPSCOMB, D. 1998. Basics of Cladistic Analysis. Student
guide paper. George WashingtonUniversity. http://
www.gwu.edu/~clade/faculty/lipscomb/Cladistics.pdf
(23 Januari 2011).
MCDONALD, J.H and M. KREITMAN. 1991. Adaptive protein
evolution at the Adh locus in Drosophila. Nature.
351: 652 – 654.
MOUNT, D.W. 2001. Phylogenetic prediction. In:
Bioinformatic, Sequence and Genome Analysis. Cold
Spring Harbor laboratory. New York Press pp. 237 –
280.
MUNSTER, V.J., A. WALLENSTEN, C. BAAS, G. F.
RIMMELZWAAN, M. SCHUTTEN, B OLSEN, A. D.M.E.
OSTERHAUS and R.A.M. FOUCHIER. 2005. Mallards
and Highly Pathogenic Avian Influenza Ancestral
Viruses, Northern Europe. EID: 1545 – 1551.
NEI, M. 1987. Molecular Genetics. Columbia University New
York Press.
NIELSEN, R. and Z. YANG. 1998. Likehood models for
detecting positively selected amino acid sites and
application to the HIV-1 envelope gene. Genetics.
148: 929 – 936.
NOTREDAME, C. 2007. Recent evolutions of multiple
sequence alignment algorithms. PLOS Comput. Biol.
3: E123.
SAITOU, N. and M. MEI. 1987. The neighbor-joining method:
A new method for constructing phylogenetic trees.
Mol. Biol. Evol. 4: 406 – 425.
SAITOU, N. and T. IMANISHI. 1989. Relative efficiencies of the
Fitch-Margoliash, Maximum-Parsimony, MaximumLikehood, Minimum Evolution amd Neighbor-joining
Methods of phylogenetic tree construction in
obtaining the correct tree. Mol. Biol. Evol. 6(5): 514
– 525.
SCHADT, E.E., J.S. SINSHEIMER and K. LANGE. 1998.
Computational advances in maximum likehood
methods for molecular phylogeny. Genome Res. 8:
222 – 233.
9
WARTAZOA Vol. 21 No. 1 Th. 2011
SCHMIDT, H. 2003. Phylogenetic Trees from Large Datasets.
Inaugural-Dissertation, Dusseldorf University. http://
www.bi.uniduesseldorf.de/~hschmidt/publ/schmidt20
03.phdthesis.pdf. (23 Januari 2011).
SWOFFORD, D.L., G.J. OLSEN., P.J. WADDELL and D.M. HILLS.
1996. Phylogenetic inference. In: Molecular
Systematics, 2nd Edition. HILLS, D.M., C. MORITZ and
B.K. MABLE (Eds.) Sinauer Associates, Sunderland,
Massachusetts. Chap. 5 pp. 407 – 514.
10
WEISS, K.M. 1995. Genetic variation and human diseases:
Principles and evolution approaches. Cambridge
University Press, Cambridge. 354 p.
Fly UP