...

IDENTIFIKASI26 ISOLAT BAKTERI ENDOFITIK DAN FILOSFER

by user

on
Category: Documents
0

views

Report

Comments

Transcript

IDENTIFIKASI26 ISOLAT BAKTERI ENDOFITIK DAN FILOSFER
Berita Biologi 10(4) - April 2011
IDENTIFIKASI26 ISOLAT BAKTERI ENDOFITIK DAN FILOSFER
PADI DENGAN ANALISIS SEKUEN16S RDNA1
[Identification of 26 Endophytic and Phyllosphere Bacteria Isolated from Rice by
16S rDNA Sequence Analyses]
Nurul Hidayatun0*, Dwi N Susilowati dan K Mulya
Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian,
Badan Penelitian dan Pengembangan Pertanian
JlnTentaraPelajar3A,Bogor-16111 Tip. 0251-8337975, Fax. 0251-8338820
HP 081802969600; *e-mail: [email protected]
ABSTRAK
Penelitian dimaksudkan untuk mengidentifikasi 26 isolat bakteri endofit dan filosfer yang diisolasi dari 4 varietas padi, dengan
menggunakan metode sequencing terhadap 16S rDNA. Sekuen DNA kemudian disejajarkan dengan sekuen referen dari perpustakaan
data bank gen dengan menggunakan program BLAST dari NCBI untuk menemukan identitas yang paling dekat keterkaitannya
dengan isolate yang dianalisis. Analisis sekuensing menunjukkan bahwa beberapa isolat yang dianalisis memiliki identitas yang dekat
dengan Staphyllococcus dan Serratia (masing-masing 5 isolat), Bacillus (4 isolat), Microbacteria (3 isolat), Pseudomonas (2
isolat) dan Klebsiella, Acidovorak, Bulkholderiaceae, Agrobacterium and Shewanella (masing-masing satu isolat). Tidak ada
isolate tertentu yang mendominasi pada kedua kelompok bakteri endofit dan filosfer, dan juga tidak ditemukan isolat spesifik-inang
pada keempat varietas padi.
Kata kunci: BLAST, bakteri endofit, 16S rDNA, sekuensing
ABSTRACT
The research was subjected to identify 26 endophytic and phyllosphere bacteria isolated from 4 rice varieties using sequencing
method of 16S rDNA. The sequences were then aligned with reference sequence from Gen-Bank data library by BLAST program
from NCBI to find the most related identity of the isolates analysed. The sequencing analysis revealed that some isolates have a
high identity to Staphylococcus and Serratia (5 isolates each), Bacillus (4 isolates), Microbacteria (3 isolates), Pseudomonas (2
isolates) and Klebsiella, Acidovorak, Bulkholderiaceae, Agrobacterium and Shewanella (1 isolate each). No specific isolate
dominated in both endophytic and phyllosphere group, nor host-specific isolate found in the four rice varieties.
Key words: BLAST, endophytic bacteria, 16S rDNA, sequence
PENDAHULUAN
Bakteri endofit didefinisikan sebagai bakteri
yang terdapat di permukaan dan di dalam jaringan
tumbuhan, yang bersifat tidak berbahaya bagi
tumbuhan (Mano and Morisaki, 2008). Bakteri endofit
diduga berasal dari lingkungan luar tumbuhan dan
kemudian masuk ke dalam jaringan tumbuhan melalui
stomata, lentisel, luka, daerah pemunculan tunas akar
lateral dan tunas perkecambahan (Huang, 1986). Di
dalam jaringan tumbuhan biasanya bakteri endofit akan
berkoloni pada daerah ruang interseluler dan sistem
vaskular (Hallman et al, 1997).
Beberapa bakteri endofit telah diketahui
bermanfaat bagi tumbuhan yang ditumpanginya melalui
sebuah interaksi berupa hubungan saling
ketergantungan yang bersifat mutualisme. Beberapa
bakteri endofit telah diketahui bermanfaat dalam
menunjang pertumbuhan tumbuhan misalnya sebagai
biofertiliser dengan cara bersimbiosa dengan tanaman
padi dalam penambatan nitrogen, produsen senyawa
antibiotik dan antifungi (Strobel and Daisy, 2003), dan
produsen regulator pemacu tumbuh seperti etilen,
auksin, dan sitokinin (Kloepper et al, 1991; Hoflich et
al., 1994). Bakteri endofit pada tanaman padi memiliki
gen fungsional yang diduga terkait dengan
penyebarannya di dalam jaringan tanaman. (Mano and
Morisaki, 2008).
Eksplorasi terhadap bakteri endofit yang
bermanfaat dapat dilakukan pada tumbuhan yang
memiliki keunikan dalam beberapa hal seperti
kemampuan tumbuh pada suatu kondisi lingkungan
tertentu, strategi pertahanan terhadap hama/penyakit,
sejarah etnobotani dan pemanfaatannya oleh
masyarakat, dan keberadaannya sebagai tumbuhan
endemik ataupun tumbuhan yang berasal dari daerah
dengan keragaman biodiversitas yang tinggi (Strobel
and Daisy, 2003).
Untuk menjembatani pemanfaatan kultur hasil
eksplorasi diperlukan studi lanjutan yang meliputi
berbagai tahapan karakterisasi secara morfologi,
'Diterima: 01 Mi 2010 - Disetujui: 16 Nopember 2010
455
Hidayatun, Susilowati dan Mulya - Identjfikasi Isolat Bakteri Endofitik dan Filosfer Padi dengan Analisis Sekuen 16S rDNA
fisiologi, biokimia hingga tingkat molekuler.
Karakterisasi pada tingkat molekuler dapat dilakukan
dengan mengamati profil gen 16s rDNA (Weidner et
al, 1996). Berdasarkan sekuen DNA-nya dapat diduga
identitifikasi dan direkonstruksi pohon filogenetik yang
akan mengelompokkan bakteri berdasarkan jarak
kekerabatannya. Penggunaan sekuen 16S rDNA untuk
identifikasi dan studi kerabatan telah banyak dilakukan
(Drancourt et al, 2000; Wesburg et al, 1991).
Saat ini telah tersedia piranti program untuk
mengelompokkan dan mengetahui identitas suatu
isolat misalnya program BLAST {Basic Local
Alignment Search Tool) yang merupakan program
penjajaran sekuens (sequence alignment) yang
digunakan untuk membandingkan sekuens informasi
biologi. Bermacam kegunaan dalam riset gen telah
dibuat berdasarkan program tersebut misalnya
identifikasi spesies, membuat pohon filogeni,
memetakan DNA, pembandingan, dan melokasikan
domains (Soendoro, 2010).
Sebanyak 155 isolat bakteri telah diisolasi dari
bagian batang, daun, dan akar tanaman padi dari
varietas Cirata, Limboto, Code dan IR64 dari
pertanaman padi di daerah Cikembar, Sukabumi, Jawa
Barat pada tahun 2004. Beberapa isolat merupakan
isolat endofitik tanaman padi setelah dilakukan
pengujian autentifikasi terhadap koleksi ini di rumah
kaca dengan tanaman inang yang sama (Mulya et al.,
2004). Cirata merupakan varietas lokal yang peka
terhadap Pyricularia grissea penyebab penyakit bias;
Limboto merupakan varietas lokal tahan terhadap fungi
tersebut; Varietas Code adalah turunan IR64 yang
tahan terhadap bakteri Xanthomonas oryzae penyebab
penyakit Hawar Daun Bakteri (HDB); sedangkan
varietas IR64 sendiri bersifat peka (Lesmana et al, 2003).
Studi lanjutan terhadap isolat bakteri endofit dan
filosfer yang meliputi karakterisasi morfologi dan
fisiologi telah dilakukan. Beberapa isolat bakteri
menunjukkan karakter sebagai penambat N2 dan
antifungi (Mulya et al, 2004; Susilowati et al, 2006).
Penelitian ini dilakukan sebagai tahapan lanjutan untuk
karakterisasi molekular bakteri endofit tanaman padi
yang dilakukan dengan pendekatan teknik sekuensing
terhadap gen 16S rDNA. Melalui penelitian ini
diharapkan dapat diperoleh informasi mengenai jenis-
456
jenis bakteri endofit pada tanaman padi Indonesia.
BAHANDANMETODE
Penelitian dilakukan di Laboratorium
Mikrobiologi dan Laboratorium Terpadu Balai Besar
Penelitian dan Pengembangan Bioteknologi dan
Sumberdaya Genetik Pertanian-Badan Penelitian dan
Pengembangan Pertanian (BB Biogen) pada tahun 2006.
Bahan penelitian adalah beberapa isolat bakteri endofit
dan filosfer koleksi BB Biogen. Isolat-isolat tersebut
merupakan bakteri yang diisolasi dari tanaman padi
varietas IR64, Cirata, Limboto, dan Code yang telah
diautentifikasi untuk mengkonfirmasi kembali
keterkaitan asal bakteri dengan tanaman inangnya
(Mulya et al, 2004). Primer yang digunakan adalah 63F (CAGGCCTAACACATGCAAGTC), 1387-R
(GGGCGGCGTGTACAAGGCC) dari lnvitrogen dan
bahan-bahan pendukung lain. Tahapan kerja meliputi
kegiatan isolasi dan amplifikasi gen 16S rDNA,
purifikasi produk PCR, sekuensing, presipitasi, deteksi
sekuen, dan analisis sekuen .
Isolasi dan Amplifikasi Gen 16S rDNA
Isolasi DNA bakteri dilakukan dengan protokol
dari Lazo et al. (1997) yang diawali dengan tahap
pembiakan pada media cair King's B dan proses
ekstraksi dengan bufer STE, SDS 10% dan proteinaseK (Susilowati et al., 2006). Amplifikasi DNA/
Polymerase Chain Reaction (PCR) dilakukan pada mesin
PCR DNA Engine Tetrad® 2 Peltier Thermal Cycler MJ
Research. Sebanyak 2 ul DNA genom bakteri
konsentrasi 10-20 ng/ul dicampurkan dalam larutan
komponen PCR yang terdiri diri: 2,5 ul 1 Ox bufer PCR,
1,50 ul25 mM MgCL,, 0,50 ul 10 mMdNTP, masingmasing 0,50 ul 10 mM primer Forward dan Reverse,
dan 0,20 ul enzim Taq DNApolimerase dengan pelarut
air deionisasi hingga volume total menjadi 25 ul. PCR
dijalankan dengan profil sebagai berikut: predenaturasi
pada suhu 94°C selama 2 menit, diikuti dengan 30 siklus
tahapan dari denaturasi pada suhu 94°C Selama 30 detik,
penempelan primer (annealing) dengan variasi suhu
50°C dan 55°C selama 30 detik, polimerasi pada suhu
72°C selama 1 menit. Pada siklus terakhir waktu
polimerasi diperpanjang menjadi 7 menit dan pada
tahap terakhir dilakukan penurunan suhu ke 4°C untuk
menghentikan reaksi PCR (Rodiyah, 20Q3).
Berita Biologi 10(4) - April 2011
Tabel 1. Hasil identifikasi bakteri endofit berdasarkan hasil penyejajaran data sekuen DNA
dengan program BLAST
No
Kode Isolat
Tanaman
inang
Karakter *
Sifat
Gram*
Panjang
nukleotida
1
Endo-20
Cirata
-
Negatif
2
Endo-26
Cirata
Antifungi
3
Endo-40
Cirata
4
Endo-41
5
Endo-42
6
Endo-47
Cirata
7
Endo-51
Cirata
8
Endo-63
Cirata
98
Endo-65
Limboto
10
Endo-68
11
12
Spesies referen
terdekat
Tingkat
homologi
661
Pseudomonasfulva
97
Negatif
893
Serratia marcescens
95
-
Negatif
953
Sen alia sp.
96
Cirata
-
Positif
886
Staphylococcus sp.
96
Cirata
-
Positif
698
Staphylococcus sp.
96
-
Negatif
586
Serratia Marcescens
98
-
Positif
688
Bacillus cereus
98
Antifungi
Positif
757
Microbacterium sp.
78
Positif
863
Bacillus subtilis
97
Limboto
Penambat N2
dan Antifungi
-
Positif
835
Microbacteriaceae
98
Endo-69
Limboto
Antifungi
Positif
828
Microbacteriaceae
95
Endo 76
Limboto
Antifungi
Positif
948
Staphylococcus sp.
95
13
Endo-79
Limboto
Antifungi
Positif
505
Staphylococcus sp.
78
14
Endo-89
Limboto
Penambat N2
Positif
659
Staphylococcus sp.
96
15
Endo-91
Limboto
Penambat N2
dan Antifungi
Negatif
861
Pseudomonas syringae
92
16
Endo-105
Limboto
Negatif
753
Klebsiella sp.
97
17
Endo-107
Limboto
Penambat N2
Negatif
518
Acidovorax sp.
91
18
Endo-127
Limboto
Penambat N2
Negatif
760
Burkholderiaceae
97
692
Bacillus subtilis
94
Agrobacterium
larryymoorei
96
19
Endo-128
Limboto
Positif
20
Endo-135
Code
Negatif
716
21
Endo-136
Code
Positif
866
Bacillus sp.
95
900
930
Serratia marcescens
Serratia marcescens
96
96
23
Endo-147
Filo-10
IR64
IR64
Penambat N2
Penambat N2
Negatif
Negatif
24
Filo-20
Limboto
Penambat N2
Negatif
678
Enterobacter sp.
96
541
Pseudomonas sp.
85
636
Enterobacter sp.
98
22
25
Filo-22
Limboto
Penambat N2
Negatif
26
Filo-44
Limboto
Penambat N2
Negatif
•Karakter diperoleh dari laporan hasil penelitian (Mulya et al., 2004 dan Susilowati et al., 2006).
Purifikasi Produk PCR
Purifikasi produk PCR dilakukan untuk
menghilangkan residu primer atau dNTP dari produk
PCR 16s ribosomal DNA yang berpotensi menghasilkan
produk-produk yang tidak spesifik. Proses ini dilakukan
dengan menginkubasikan produk PCR dalam larutan
Shrimp Alkaline
Phosphatase
(SAP)
dan
Exonucleasel (Exol) dengan perbandingan2 unit SAP
: 1 unit exol untuk 6ul produk PCR. Inkubasi dilakukan
jrada suhu 37°C selama 1 jam, yang dilanjutkan dengan
inaktivasi enzim pada suhu 80°C selama 15 menit dan
4°C untuk penyimpanan reaksi yang sudah murni.
Pengecekan di agarosa dilakukan untuk memastikan
bahwa produk PCR masih ada dan sudah murni yang
ditunjukkan oleh tidak adanya fragmen lain.
Reaksi Sekuensing dengan Kit DTCS (Dye
Terminator Cycle Sequencing)
Reaksi sekuensing dilakukan dengan formula
8,3 ul dH20,6 ul template DNA, 1,7 ul primer tunggal
(63-F) dan 4 ul DTCS mix. Program sekuensing
dilakukan dengan kondisi sebanyak 44 siklus yang
terdiri atas suhu 96°C selama 20 detik, 50°C selama 20
detik, dan 60°C selama 4 menit dan kemudian dilanjutkan
dengan satu tahap pada suhu 4°C selama 1 jam.
457
Hidayatun, Susilowati dan Mulya - Identifikasi Isolat Bakteri Endofitik dan Filosfer Padi dengan Analisis Sekuen 16S rDNA
Endo 107
Ends 63
Endo 79
Gambar 1. Kontruksi pohon filogenetik dari isolat bakteri endofit dan filosfer.
Presipitasi ethanol
Pencucian diawali dengan menambahkan 2 ul
3M NaOAc, 2 ul 100 mM EDTA dan 1 ul glikogen pada
produk sekuensing. Larutan dicampur dan ditambah
60 ul95% etanol dingin (-20°C), divorteks, kemudian
disentrifugasi pada kecepatan 4100 rpm pada suhu 4°C
selama 10 menit. Kemudian supernatan dibuang dan
pada presipitat ditambahkan 200 ul etanol 70% dingin
(-20°C) dan disentrifugasi selama 3 menit. Proses
pencucian ini dilakukan dua kali dan kemudian hasil
pencucian terakhir dikering anginkan.
Deteksi sekuen
Deteksi hasil sekuensing dilakukan dengan
menambahkan 40 SLS sebagai pelarut. Proses deteksi
sekuen dilakukan dengan elektroforesis kapiler pada
mesin sequencer CEQ 8000 Genetic Analyser dari
Beckman.
Analisis Hasil
Keluaran dari proses sekuensing adalah berupa
sekuen urutan basa nukleotida. Hasil sekuen kemudian
disejajarkan dengan data GenBank menggunakan
program BLAST-N {Basic Local Alignment Search
Tool-Nucleotida) untuk mengetahui kemiripan spesies
dari isolat yang diuji. Program untuk analisis ini tersedia
secara online dari situs NCBI {National Center for
Biotechnology Information). Hubungan kekerabatan
antar isolat dianalisis berdasarkan kontruksi pohon
filogeninya. Sekuen DNA isolat disejajarkan dengan
458
menggunakan program multiple sequences alignment
ClustalW2 dari European Bioinformatics Institute
(EBI), dan pohon filogenetik dibuat dengan
menggunakan program TreeCon.
HASIL
Identitas isolat
Hasil deteksi sekuen 16S rDNA mempunyai
kisaran panjang dari 505 sampai 953 basa nukleotida.
Hasil analisis kesejajaran sekuen 16S rDNA dengan
sekuen database yang dilakukan dengan program
BLAST dari NCBI menunjukkan kemiripan dengan
berbagai macam species bakteri dengan berbagai
tingkat kemiripan. Sebanyak4 isolat terdeteksi sebagai
Serratia, 5 isolat Staphyllococcus, 4 isolat Bacillus, 3
Pseudomonas, 3 Microbacterium, 2 Enterobacter dan
masing-masing satu isolat teridentifikasi sebagai
Klebsiella sp., Acidovorak sp., Burkholderiaceae,
Agrobacterium larrymoorei dan Methilococcus
capsulatus (Tabel 1).
Hubungan kekerabatan antarisolat
Pohon filogenetik mengelompokkan isolat yang
diteliti dalam beberapa klaster. Tidak ada
kecenderungan pengelompokan isolat berdasarkan
pada varietas tanaman inangnya. Klaster-klaster yang
terbentuk menunjukkan kekhususan pada sifat Gram
isolat dan identitasnya. Isolat yang bersifat gram positif
membentuk tiga klaster yaitu klaster Staphylococcus,
Berita Biologi 10(4) - April 2011
klaster Bacillus dan klaster Microbacteriaceae;
sedangkan isolat yang bersifat Gram negatif
membentuk klaster Serratia dan klaster Pseudomonas
(Gambarl.)
PEMBAHASAN
Terdapat kesamaan identitas dua strain bakteri
yang diisolasi dari dalam jaringan tanaman (endofit)
dan yang diisolasi dari daun (filosfer) yaitu Serratia
dan Pseudomonas yang ditemukan pada kedua lokasi
jaringan tersebut. Kesamaan jenis mikroba pada
jaringan tubuh yang berbeda adalah hal yang biasa.
Beberapa bakteri endofit yang terdeteksi di dalam akar,
biji dan daun juga ditemukan di lingkungan sekitarnya.
Mano et al. (2007) yang mengamati flora endofit dan
permukaan pada biji dan daun padi di sawah
menemukan bahwa beberapa bakteri endofit yang
tinggal di dalam biji dan daun juga ditemukan pada
permukaan kedua lokasi tersebut. Diduga sangat
mungkin terjadi perpindahan dari masing-masing
bagian tanaman tersebut. Sebagaimana dikemukakan
oleh Di Fiori and Del Gallo (1995) bahwa kebanyakan
bakteri endofitik yang berhasil diisolasi dari jaringan
tumbuhan bersifat endofitik fakultatif dan mampu
berada di bagian luar jaringan tumbuhan sebagai
bakteri rhizosfer.
Hal lain yang dapat dikemukakan berdasarkan
Tabel 1 adalah bahwa tanaman padi baik varietas
Limboto, Code, Limboto dan IR64 ternyata secara
simultan dapat dikolonisasi oleh beragam jenis bakteri
endofit yang berkisar dari bakteri gram positif dan gram
negatif. Tanaman padi merupakan mikroekosistem yang
kompleks sehingga beragam jenis mikroba dapat
ditemukan berinteraksi dan berada dalam keadaan
keseimbangan (ekuilibrium), walaupun beberapa jenis
tetap menjadi spesies yang dominan dan beberapa
lainnya sebagai spesies yang jarang (Van Peer et al.,
1990). Fenomena ini didapati oleh Gardner et al. (1982),
yang melakukan identifikasi bakteri yang berada di
dalam cairan xylem dari akar tanaman jeruk lemon
Florida. Diantara 13 jenis yang ditemukan, jenis yang
paling sering ditemukan atau disebut sebagai spesies
dominan adalah Pseudomonas (40%) dan Enterobacter
(18%); sedangkan jenis lainnya hanyalah spesies yang
jarang. Kestabilan biodiversitas inilah yang
dipertimbangkan sebagai kondisi yang paling penting
untuk keberlanjutan suatu ekosistem.
Empat isolat endofit (Endo-26, Endo-40, Endo
47, Endo-147) dan satu isolat Filosfer (Filo-10)
teridentifikasi sebagai Serratia. Keberadaan dan
fungsi Serratia pada pertanaman padi telah disebutkan
pada beberapa penelitian. Gyaneshwar et al. (2001)
yang mengisolasi bakteri diazotrofik dari akar dan
batang beberapa varietas padi juga menemukan bakteri
yang teridentifikasi sebagai Serratia marcescens;
sementara Someya et al. (2002) memiliki strain Serratia
yang mampu mengontrol penyakit blast yang
disebabkan oleh Pyricularia orizae.
Keempat isolat Serratia yang yang terdeteksi
dalam penelitian ini diperoleh dari tanaman varietas
padi yang peka terhadap patogen blast dan hawar daun
bakteri (HDB). Dua isolat hasil isolasi dari IR64 memiliki
kapasitas penambatan terhadap N2 dan satu isolat dari
padi varietas Cirata memiliki aktivitas antifungi. Cirata
diketahui merupakan tanaman yang peka terhadap
penyakit bias dan IR 64 peka terhadap HDB.
Dimungkinkan bahwa isolat yang teridentifikasi sebagai
Serratia dalam penelitian ini merupakan strain yang
berbeda.
Empat isolat bakteri endofit teridentifikasi
sebagai Bacillus. Kelompok Bacillus yang hidup di
dalam jaringan tanaman padi diketahui cukup bervariasi
dan tersebar luas dalam berbagai bagian jaringan
tanaman seperti biji, daun, batang dan akar (Mano et
al., 2007). Diketahui bahwa banyak isolat kelompok
Bacillus yang mempunyai efek biologis terhadap
beberapa jenis pathogen tanaman. Isolat Endo-65 yang
memiliki kemampuan sebagai penambat N2 dan
antifungi teridentifikasi sebagai Bacillus subtilis. Isolat
ini sebelumnya juga telah teridentifikasi sebagai bakteri
kelompok Bacillus berdasarkan karakter morfologi,
fisiologi dan biokimianya (Susilowati et al., 2005). Isolat
ini diperoleh dari tanaman inang padi varietas Limboto
yang bersifat tahan terhadap penyakit bias. Perlu
penelitian lebih lanjut untuk mengetahui apakah sifat
ketahanan ini terkait dengan simbiosa tanaman ini
dengan isolat Endo-65 ataukah terkait oleh mekanisme
yang lain.
Sebanyak lima isolat endofit teridentifikasi
sebagai Staphylococcus. Bakteri kelompok Firmicutes
459
Hidayatun, Susilowati dart Mulya - Identifikasi Isolat Bakteri Endofitik dan Filosfer Padi dengan Analisis Sekuen 16S rDNA
ini telah dilaporkan ditemukan pada isolat yang berasal
dari bagian permukaan dan di dalam padi gilingan
melalui metode non kultur (Huang 1986 dalam Mano
dan Morisaki, 2008). Satu dari lima isolat ini memiliki
kapasitas antifungi dan dua isolat merupakan penambat
Nr Beberapa isolat lain teridentifikasi dekat dengan
Pseudomonas,
Microbacterium,
Acidovorax,
Klebsiella, Bulkholderiaceae, Agrobacterium dan
Methilococcus capsulatus. Jenis-jenis bakteri ini juga
telah dilaporkan keberadaannya pada tanaman padi
(Mano and Morisaki, 2008). Isolat Endo-63 dan Endo69 yang memiliki potensi sebagai antifungi
teridentifikasi sebagai Microbacteriaceae.
Pohon filogenetik memberikan hasil yang
mendukung analisis BLAST. Pengelompokan terjadi
berdasarkan identitas dan sifat bakteri dan tidak
ditemukan adanya pengelompokan isolat berdasarkan
varietas tanaman inangnya. Bakteri gram positif dan
Gram negatif terpisah dalam dua klaster besar. Dalam
masing-masing klaster tersebut kemudian terbentuk
sub-sub klaster yang lebih spesifik seperti sub-klaster
Staphylococcus, Bacillus dan Microbacteriaceae dari
kelompok bakteri gram positif, dan sub-klaster
Pseudomonas dan Serratia dari kelompok bakteri gram
negatif.
Tidak ditemukan suatu isolat yang spesifik pada
tanaman inang (varietas padi) tertentu. Beberapa isolat
antifungi ditemukan pada tanaman yang peka terhadap
patogen yang disebabkan oleh fungi dan tidak
ditemukan pada tanaman yang tahan. Hal ini
dimungkinkan oleh karena gen fungsional bakteri ini
berkaitan dengan distribusinya di dalam jaringan
tanaman (Mano dan Morisaki, 2008). Selain itu
keragaman jenis isolat pada beberapa bagian tanaman
juga mengalami perubahan pada stadia pertumbuhan
yang berbeda, sehingga untuk mengetahui peran
fungsional dari isolat diperlukan eksplorasi jenis-jenis
isolat endofit pada berbagai stadia pertumbuhan (Mano
et al., 2007).
KESIMPULAN
Bakteri endofit dan filosfer pada tanaman padi
varietas IR64, Cirata, Limboto dan Code teridentifikasi
sebagai bakteri kelompok Staphylococcus dan Serratia
(5 isolat), Bacillus (4 isolat), Microbacteria (2 isolat),
460
Pseudomonas (3 isolat), Enterobacter (2 isolat) dan
Klebsiella, Acidovorak, Bulkholderiaceae, dan
Agrobacterium (masing-masing 1 isolat). Tidak
ditemukan kekhasan antara varietas padi dan isolat
yang ditemukan di dalamnya.
SARAN
Jenis-jenis bakteri yang diteliti diketahui
bermanfaat bagi tumbuhan. Akan tetapi untuk
mengetahui manfaatnya secara lengkap dibutuhkan
studi lanjut yang lebih mendalam.
UCAPANTERIMAKASIH
Penelitian ini merupakan bagian dari Proyek
Penelitian yang dibiayai dengan sumber dana DIPA
APBN TA 2006 Balai Besar Penelitian dan
Pengembangan Bioteknologi dan Sumberdaya Genetik
Pertanian (No. DIPA 503 8.0460 A1). Penanggung jawab
Dwi Ningsih Susilowati, M.Si. Penulis mengucapkan
terima kasih kepada Siti Aminah atas bantuannya dalam
penyelesaian kegiatan ini.
DAFTARPUSTAKA
Di Fiori S and M Del Gallo. 1995. Endophytic bacteria:
their possible role in the host plant. In: Azospirillum
VI and Related Microorganisms. I Fendrik, M Del
Gallo, J Vanderleyden and M de Zamaroczy (Eds.).
Springer-Verlag, Berlin.
Drancoutr M, C Boiler, A Carlioz, R Martelin, JP Gayral
and D Raoult. 2000. 16S ribosomal DNA sequence
analysis of a large collection of environmental and
clinical unidentifiable bacterial isolates. Journal of
Clinical Microbiology 38(10), 3623-30.
Gardner JM, AW Feldman and DH Stamper. 1983. Role
and fate of bacteria in vascular occlusion of citrus.
Physiological Plant Pathology 23, 295-303.
Gyaneshwar P, EK James, N Mathan, PM Reddy, B
Reinbold-Hurek and J Ladha. 2001. Endophytic
colonization of rice by a diazotrophic strain of Serratia
marcescens. Journal of Bacteriology. 183, 2634-2645.
Hallman J, AQ Hallman, WF Mahaffee and JW Kloeper.
1997. Bacterialendophytes in agricultural crops.
Canadian Journal of Microbiology 43(10), 895-914.
Hoflich G, W Wiehe and G Kihn. 1994 Plant growth
stimulation by inoculation with symbiotic and
associative rhizosphere mechanisms. Experientia 50,
897-905.
Huang JS. 1986. Ultrastructure of bacterial penetration in
plants. Annual Review of Phytopatology 24, 141- 57.
Kloepper JW, EM Tipping and R Lifshitz. 1991. Plant
growth promotion mediated by bacteria] rhizosphere
colonizers. In: The Rhizosphere and Plant Growth,
315-326. DL Keister and PB Cregan (Eds.). Kluwer
Academic Publishers, Dordrecht, The Netherlands.
Lazo GR, R Roffey and DW Gabriel. 1987. Conservation
Berita Biologi 10(4) - April 2011
of plasmid DNA sequences and pathovar identification
of strains
of Xanthomonas
campestris.
Phytopathology 77, 448-453.
Lesmana OS, HM Toha dan I Las. 2003. Deskripsi Varietas
Unggul Baru Padi. Balai Penelitian Tanaman Padi,
Sukamandi.
Mano H and H Morisaki. 2008. Minireview: Endophytic
bacteria in the rice plant. Microbes and Environments
23, 109-117.
Mano H, F Tanaka, C Nakamura, H Kaga and H
Morisaki. 2007. Cultivable endophytic bacterial flora
of the maturing leaves and roots of rice plants (Oryza
saliva) cultivated in a paddy field. Microbes and
Environments 22, 175-185.
Mulya K, DN Susilowati, A Akhdiya, I Manzila, H
Purwanti, RD Hastuti, D Wahyuno, D Manohara,
H Kurniawan, N. Azizah, S Soedjono dan
Simanungkalit. 2004.
Konservasi dan
Karakterisasi Genetik Mikroba Pertanian. Laporan
Hasil Penelitian. Balai Besar penelitian dan
Pengembangan Bioteknologi dan Sumberdaya Genetik
Pertanian, Bogor.
Rodiyah. 2003. Distribusi dan Diversitas Genetik Bakteri
Diazotrof Endofitik pada Tebu (Saccharum
qfficinarum L). Tesis. Program Pasca Sarjana UGM,
Yogyakarta.
Soendoro D. 2010. Dynammic programming dalam
menentukan arti urutan untaian gen IF3051 strategi
algoritmik Tahun 2009/2010. Makalah. Program Studi
Teknik Informatika, Sekolah Teknik Elektro dan
Informatika, Institut Teknologi Bandung.
Someya N, M Nakajima, T Hibi, I Yamaguci and
K Akutsu. 2002. Induced resistance to rice blast by
antagonistic bacterium Serratia marcescens Strain B2.
General Plant Pathology 68, 177-182.
Strobel G and B Daisy. 2003. Bioprospecting for microbial
endophytes and their natural products. Microbiology
and Molecular Biology Reviews 67 (4), 491-502.
Susilowati DN, K Mulya, N Azizah, H Purwanti, A
Suhendar, I Manzila, RD Hastuti, D Wahyuno,
D Manohara, N Hidayatun, S Salma, Nurichana,
S Soedjono, R Saraswati dan K Herlina. 2005.
Konservasi dan Karakterisasi Mikroba Pertanian.
Laporan Hasil Penelitian. Balai Besar penelitian dan
Pengembangan Bioteknologi dan Sumberdaya Genetik
Pertanian, Bogor.
Susilowati DN, A Akhdiya, K Mulya, E Pratiwi, H
Purwanti, A Suhendar, I Manzila, RD Hastuti, D
Wahyuno, D Manohara, N Hidayatun, S Salma,
Nurichana, S Soedjono, R Saraswati dan K
Herlina. 2006. Konservasi dan Karakterisasi
Mikroba Pertanian. Laporan Hasil Penelitian. Balai
Besar penelitian dan Pengembangan Bioteknologi dan
Sumberdaya Genetik Pertanian, Bogor.
Van Peer R, HLM Punte, LA De Wega and B Schippers.
1990. Characterization of root surface and
endorhizosphere Pseudomonads in relation to their
colonization of roots. Applied and Environmental
Microbiology 56, 2462-2470.
Weidner S, W Arnold and A Pukle. 1996. Diversity of
uncultured microorganisms associated with the seagrass
Halophila stipulacea estimated by retriction
fragmenth length polymorphim analysis of gen
encoding 16S rRNA and 23S rRNA intergenic spacers,
repetitive extragenic palindromic PCR genomic finger
printing and partial 16S rRNA sequencing. Applied
and Environmental Microbiology 64, 2096-2104.
Wiesburg WG, SM Barns, DA Pelletier and DJ Lane.
1991. 16S ribosomal DNA amplification for
phylogenetic study. Journal of bacteriology, 173(2),
697-703.
461
Fly UP